Latihan soal Penilaian Tengah Semester Ganjil Biologi Kelas XII SMA-MA




Siang ini saya postkan latihan-latihan soal penilaian tengah semester dengan 3 pokok bahasan meliputi:
o   Pertumbuhan dan perkembangan makhluk hidup
o   Metabolisme
o   Substansi genetik

SOAL BANYAK BERSUMBER DARI PAKET SOAL UJIAN NASIONAL TAHUN 2010 SAMPAI PAKET SOAL UJIAN NASIONAL 2016

Dengan harapan anak-anakku bisa belajar dan memperdalam lagi materi yang sudah dipelajari didalam kelas.
Belajar kapan saja dan dimana saja

SELAMAT MENGERJAKAN


1.      Pada tumbuhan, cahaya sangat dibutuhkan dalam proses fotosintesis, tetapi keberadaannya menghambat pertumbuhan. Untuk membuktikan bahwa cahaya menghambat pertumbuhan dapat dilakukan dengan cara mengamati ....
A.     Hasil uji iodium pada daun yang ditutup dengan kertas aluminium
B.     Jumlah daun yang muncul pada pertumbuhan kecambah di tempat gelap
C.     Kecambah yang diletakkan dalam botol tertutup
D.     Pertumbuhan kecambah di tempat gelap dan terang
E.     Pertumbuhan kecambah di tempat Gelap

2.      Biji kacang hijau direndam dalam air selama 2 jam, lalu dipindahkan ke dalam wadah tertutup. Beberapa hari kemudian, biji mengalami perkecambahan. Peran air pada proses perkecambahan biji tersebut adalah ....
A.     Merangsang kerja auksin.
B.     Menyerap zat makanan dalam biji.
C.     Merangsang metabolisme embrio dalam biji untuk tumbuh.
D.     Mengandung zat makanan untuk pertumbuhan embrio.
E.     Menguraikan zat amilum dalam biji.
UN11-12

3.      Dua stek batang tanaman mawar pada 2 pot (A dan B) dengan media tanam sekam padi. Setelah tumbuh tunas pada pot A diberi pupuk urea, sedangkan pada pot B tidak diberi urea. Setelah satu bulan ternyata tanaman mawar pada pot A tumbuh lebih cepat daripada tanaman pot B. Komponen pupuk urea yang menyebabkan peningkatan pertumbuhan tanaman mawar adalah ....
A.     Fosfor
B.     Hidrogen
C.     Sulfur
D.     Karbon
E.     Nitrogen
UN09-10

4.   Perhatikan data hasil percobaan tanaman kacang hijau berikut!
No
Perlakuan
Rerata pertumbuhan per hari (cm)
Rata-rata (cm)
Hari 1
Hari 1
Hari 3
Hari 4
Hari 5
1
Kacang Hijau
0,07
0,5
1,3
3,5
5
2,07
2
Kacang Hijau + Hormon Tumbuh
0,1
1,4
3,9
6,5
9,5
4,28
Dari data diatas, dapat disimpulkan bahwa, pertumbuhan kacang hijau….
A.   Hanya dapat terjadi bila ditambah hormon tumbuh
B.    Tidak dipengaruhi oleh hormon tumbuh
C.    Hanya sedikit dipengaruhi oleh penambahan hormon
D.   Sangat tergantung pada penambahan hormon
E.    Akan lebih cepat jika ditambah hormon
UN08-09

5.      Seorang siswa melakukan pengamatan pertumbuhan suatu tanaman hias. Media tanaman tersebut ada yang diberi pupuk A, pupuk B, dan pupuk C. selama 21 hari dilakukan pengukuran tinggi tanaman, jumlah bunga, dan kecerahan warna bunga. Hasil pengamatan ditampilkan pada tabel berikut.
Media tanaman diberikan pupuk
Tinggi tanaman (cm)
Jumlah  bunga
Warna bunga
A
75
10
Cerah
B
90
25
Sangat cerah
C
50
5
Kurang cerah
Yang menjadi variabel bebas dari penelitian tersebut adalah ….
A.   Macam-macam pupuk
B.    Kelembapan media tanam
C.    Kecerahan warna bunga
D.   Tinggi tanaman
E.    Jumlah bunga
UN 14-15

6.      Seorang siswa melakukan percobaan tentang pengaruh pupuk urea terhadap tanaman tomat. Setelah 1 minggu didapatkan data seperti pada tabel berikut:

Dosis pupuk
Tinggi tanaman (cm)
Rata-rata (cm)
1
2
3
1 gr
8
7
6
7
2 gr
8
10
12
10
4 gr
10
15
20
15
6 gr
6
8
4
6
10 gr
5
4
6
5

Berdasarkan data hasil percobaan, dapat disimpulkan …
A.   Dosis pupuk tidak memengaruhi pertumbuhan tanaman
B.    Pertumbuhan tanaman berbanding lurus dengan dosis pupuk
C.    Dosis pupuk semakin tinggi, pertumbuhan tanaman semakin cepat
D.   Dosis pupuk semakin rendah, pertumbuhan tanaman semakin cepat
E.    Tanaman dapat tumbuh optimal jika diberi pupuk dengan dosis 4 gram
UN 15-16

7.      Perhatikan data pengamatan panjang tanaman kacang hijau pada dua pot selama 10 hari berikut:



Hari ke
1
2
3
4
5
6
7
8
9
10
Pot A(cm)
-
0,4
1,8
2,6
3,1
4,9
5,9
6,5
7,2
7,7
Pot B(cm)
0,2
0,5
2,4
3,1
4,2
6,1
8,2
8,9
10,3
11,6

Keterangan:
Pot A: - Berisi tanah gembur
- Diletakkan di tempat terang
- Temperatur udara 25o C

Pot B: - Berisi sekam padi + pasir
- Diletakkan di tempat teduh
- Temperatur udara 24oC

Berdasarkan data di atas dapat disimpulkan bahwa pertumbuhan tanaman kacang hijau dipengaruhi oleh ....
A.  Jenis tanaman
B.  Umur tanaman
C.  Cahaya
D.  Suhu lingkungan
E.  Media dalam pot
UN09-10

8.      Tuti sedang melakukan pengamatan pertumbuhan dan tumbuhan. Dia ingin membuktikan bahwa suhu berpengaruh terhadap pertumbuhan kedua tumbuhan tersebut. tumbuhan ke-1 ditempatkan di tempat gelap sebagai variabel kontrol, sedangkan tumbuhan ke-2 ditempatkan di tempat terang. Kedua tumbuhan merupakan tumbuhan sejenis. Kesalahan apa yang dia lakukan dalam percobaan tersebut?
A.   Tidak terdapat variabel bebas untuk kedua tumbuhan tersebut
B.    Tidak melakukan pengukuran suhu lingkungan
C.    Menggunakan tumbuhan sejenis untuk tempat berbeda
D.   Tempat yang dipilih tidak sesuai dengan tujuan pengamatan
E.    Variabel kontrol seharusnya tumbuhan ke-2
UAN06

9.      Gaos melakukan percobaan seperti pada gambar di bawah ini.

Variabel yang dia buat untuk rancangan percobaannya ini adalah ...
A.   Tumbuhan sebagai variabel kontrol
B.    Data tinggi tumbuh sebagai variabel kontrol
C.    Arah sinar matahari sebagai variabel bebas
D.   Hasil pengukuran sebagai variabel bebas
E.    Tempat gelap sebagai variabel terikat
UAN06

10.   Bagian dari enzim yang merupakan komponen non protein berupa molekul anorganik disebut . . . .
A.     apoenzim
B.     koenzim
C.     kofaktor
D.     holoenzim
E.     gugus prostetik

11.   Sianida merupakan inhibitor kompetitif bagi kerja enzim dalam proses respirasi sel karena….
A.     Menempati sisi katalik enzim pada hemoglobin sehingga tidak dapat berikatan dengan oksigen
B.     Menempati sisi yang bukan enzim pada hemoglobin sehingga tidak bisa berikatan dengan oksigen
C.     Merupakan ion logam yang menghambat kerja enzim sitokrom
D.     Merupakan ion logam yang menggantikan gugus amino dalam hemoglobin
E.     Bersifat asam sehingga akan menaikkan pH dan menghalangi ikatan dengan oksigen
LKS intan Pariawara

12.   Enzim komplek tersusun atas berbagai komponen, salah satunya berupa Fe2+ dan NADH. Penggolongan Fe2+ dan NADH sebagai komponen enzim yang benar adalah….

Fe2+
NADH
A
Koenzim
Kofaktor
B
Koenzim
Apoenzim
C
Kofaktor
Koenzim
D
Apoenzim
Koenzim
E
apoenzim
kofagktor

13.   Larutan amilum yang diberi pewarna metilen biru akan berwarna biru. Jika diberi cairan saliva (ludah), warna biru tersebut akan memudar. Namun, jika larutan amilum tersebut ditambah HCl larutannya akan tetap berwarna biru. Hal ini menunjukkan bahwa kerja enzim dipengaruhi oleh …
A.   Substrat
B.    pH
C.    Inhibitor
D.   Zat pewarna
E.    Suhu
UN15-16

14.   Grafik berikut menunjukkan hubungan antara suhu dengan aktivitas enzim.


Kesimpulan berdasarkan grafik tentang enzim adalah ….
A.   Hanya bekerja pada suhu 40 0C
B.    Bekerja optimum pada suhu 40 0C
C.    Mulai bekerja pada suhu 0 0C
D.   Berhenti bekerja pada suhu 60 0C
E.    Bekerja optimum pada suhu 300 – 50 0C
UN14-15

15.   Perhatikan tabel hasil percobaan yang menunjukkan faktor-faktor yang berpengaruh terhadap kerja enzim katalase!

Perlakuan (+)
Gelembung
1
H2O2
-
2
H2O2 + hati
+++
3
H2O2 + hati + NaOH
++
4
H2O2 + Hati + HCL
+

+ = ada gelembung
- = tidak ada gelembung
Dari hasil percobaan di atas dapat disimpulkan bahwa kerja enzim katalase lebih efektif pada suasana ....
A.  panas
B.  basa
C.  dingin
D.  asam
E.  netral
UN13-14

16.   Kerja enzim dipengaruhi oleh pH. Enzim bekerja maksimal pada pH optimum, perubahan pH di bawah atau di atas pH optimal akan memengaruhi laju efektivitas enzim.
Grafik yang sesuai untuk menggambarkan hal tersebut adalah …






    
UN 15-16
17.   Pernyataan di bawah ini merupakan ciri-ciri proses metabolisme:
1)    Penguraian senyawa di dalam sel hidup
2)    Pembentukan senyawa di dalam sel hidup
3)    Menghasilkan energi dalam bentuk ATP
4)    Reaksi berlangsung dengan bantuan enzim
Ciri-ciri proses katabolisme adalah ….
A.   1 dan 2
B.    2 dan 3
C.    1 dan 3
D.   2 dan 4
E.    1 dan 4
UN 14-15

18.   Perhatikan gambar mitokondria berikut!


Reaksi respirasi yang terjadi pada bagian X adalah ....
A.   Glikolisis
B.    Siklus Krebs
C.    Fermentasi alkohol
D.   Fermentasi asam laktat
E.    Penguraian amilum

19.   Pada proses respirasi sel, zat lemak sebagai sumber energi masuk ke dalam siklus Krebs dalam bentuk …
A.   Asam lemak yang dipecah menjadi asetil Ko-A
B.    Gliserol yang dipecah menjadi asetil Ko-A
C.    Asam lemak yang dipecah menjadi gliseraldehid
D.   Asam lemak dan gliserol yang dipecah menjadi asetil Ko-A
E.    Asam lemak dan gliserol yang dipecah menjadi gliseraldehid
UN 15-16

20.   Perhatikan tahapan glikolisis secara ringkas berikut ini!
 Manakah pernyataan yang tepat terkait reaksi di atas?

X
Y
A
Membutuhkan 2 ATP
Hasil 4 ATP dan 2 NADH
B
Membutuhkan 2 ATP
Melepaskan ATP dan asetil KoA
C
Hasil 4 ATP dan 2 ATP
Membutuhkan 2 ATP
D
Hasil 2 NADH dan 1 ATP
Membutuhkan 2 ATP
E
Hasil 1 NADH dan asetil KoA
Hasil 2 ATP dan 1 NADH
 UN 14-15

21.   Perhatikan pernyataan berikut:
1)    Glukosa merupakan bahan pembentuk lemak dan protein
2)    Deaminasi protein menghasilkan glukosa dan urea
3)    Respirasi pada mitokondria menghasilkan ATP, CO2, dan H2O
4)    Gliserol memasuki proses metabolisme karbohidrat di antara glukosa dan piruvat
Pernyataan yang merupakan hubungan antara metabolisme lemak dan karbohidrat ditunjukkan oleh nomor …
A.   1 dan 3
B.    2 dan 4
C.    1 dan 4
D.   3 dan 4
E.    2 dan 3
UN 15-16

22.   Seorang siswa sedang mempraktikkan cara membuat donat. Dia menambahkan ragi ke dalam adonan tepung dan dibiarkan beberapa saat. Ternyata adonan tersebut mengembang. Hal ini terjadi karena adanya proses fermentasi yang menghasilkan …
A.   Etanol
B.    Nitrogen
C.    Oksigen
D.   Karbon dioksida
E.    Panas
UN 15-16

23.   Perhatikan struktur kroloplas berikut!
 
 Berdasarkan gambar, proses yang terjadi pada bagian X adalah ….
A.   Regenerasi RuBP
B.    Fiksasi CO2
C.    Fotofosforilasi
D.   Terbentuknya CO2
E.    Penguraian cahaya
UN 14-15

24.   Berikut ini beberapa pernyataan tentang proses anabolisme:
(1) memerlukan energi cahaya
(2) menghasilkan ATP, NADPH
(3) terjadi fotolisis H2O
(4) berlangsung pada tilakoid/grana
(5) menghasilkan glukosa
(6) terjadi fi ksasi CO2

Di antara pernyataan tersebut yang berkaitan dengan reaksi terang adalah ....
A.   (1) dan (2)
B.    (4) dan (6)
C.    (2) dan (3)
D.   (5) dan (6)
E.    (3) dan (4)
UN13-14

25.   Pada peristiwa reaksi terang terjadi reduksi NADP+ untuk membentuk NADPH. Elektron yang digunakan untuk mereduksi NADP+ berasal dari ....
A.   Fotosistem I
B.    Akseptor primer
C.    Fotosistem II
D.   O2
E.    H2O
UN11-12

26.   Tahap reaksi gelap dapat terjadi bila ....
A.   Ada cahaya, terjadi di stroma, energi dari ATP dan NADPH dari reaksi terang
B.    Ada cahaya maupun tidak ada cahaya, terjadi di stroma, tanpa energi ATP dan NADPH
C.    Ada cahaya maupun tidak ada cahaya, energi dari ATP dan NADPH dari reaksi terang
D.   Tanpa ada cahaya, di stroma, energi dari ATP dan NADPH
E.    Ada cahaya bisa terjadi di stroma dengan energi NADPH
UN12-13

27.   Perhatikan persamaan reaksi fotosintesis berikut ini!

6CO2 + 6 H2O  à C6H12O6 + X

X yang dihasilkan pada reaksi fotosintesis tersebut terbentuk pada tahap ....
A.   Fotolisis dari hasil penguraian H2O
B.    Fotolisis dari hasil penguraian CO2
C.    Fiksasi CO2 pada saat gelap
D.   Berlangsung fi ksasi CO2
E.    Reaksi terang dari hasil gliseraldehid 3-p
UN 2010-2011

28.   Perhatikan gambar proses fotosintesis berikut ini!


Berdasarkan gambar di atas, nomor 1 dan 2 adalah ....
A.   O2 dan reaksi terang
B.    O2 dan reaksi gelap
C.    NADH dan reaksi terang
D.   NADPH dan reaksi gelap
E.    ATP dan reaksi gelap

29.   Struktur DNA tersusun atas dua rangkaian polinukleotida. Satu nukleotida terdiri atas ....
A.   fosfat, gula, dan garam
B.    fosfat, glukosa, dan basa N
C.    fosfat, gula pentosa, dan asam
D.   fosfat, deoksiribosa, dan basa N
E.    fosfat, ribosa, dan basa N

30.   Kromosom dibentuk dari benang-benang kromatin pada sel yang siap membelah. Komposisi kromosom adalah ....
A.   Protein dan DNA
B.    Nukleosom dan solenoid
C.    Gugusan gula dan basa nitrogen
D.   DNA dan RNA
E.    Basa nitrogen dan asam fosfat

31.   Kelinci memiliki jumlah kromosom 44, maka kariotip kromosom pada se| hati kelinci betina adaiah....
A.   44 AA
B.    44A + XY
C.    22AA + XX
D.   22A + XX
E.    44AA + XX

32.   Pernyataan di bawah ini yang tepat tentang struktur DNA adalah ....
A.   Tersusun atas rantai ganda berpilin dan berpasangan secara paralel
B.    Tersusun atas dua rantai unit gula ribosa dan fosfat yang berselang-seling
C.    Satu nukleotida terdiri atas satu gula deoksiribosa, satu fosfat, dan empat basa nitrogen
D.   Basa nitrogennya terdiri atas adenin, guanin, sitosin, dan urasil
E.    Jumlah ikatan hidrogen yang menghubungkan purin dan pirimidin adalah enam

33.  Bentuk kromosom dengan letak sentromer agak jauh dari ujung kromosom dan biasanya membentuk huruf L

adalah bentuk …
A.    telosentrik
B.    akrosentrik
C.    submetasentrik
D.    metasentrik
E.     subakrosentrik

34.   Sepotong rantai DNA mempunyai urutan basa sebagai berikut :


Bila terjadi transkripsi urutan basa pada RNA d adalah….
A.   AUG-GCU-GAG
B.    UAC-CGA-CUC
C.    TAC-CGA-CTC
D.   UAG-GCU-GUC
E.    AUC-CGU-CUC
UN08-09

35.   Proses sintesis polipeptida dapat berlangsung secara serentak, sehingga dihasilkan protein dalam jumlah yang banyak. Hal ini disebabkan DNA …
A.   Pada proses sintesis bersifat stabil
B.    Merupakan molekul yang mudah diurai
C.    Menyimpan fragmen-fragmen secara berulang
D.   Merupakan rantai polinukleotida yang sangat sederhana
E.    Memiliki basa pirimidin dan basa purin dalam jumlah yang sama
UN 15-16

36.   Diketahui mRNA memiliki urutan basa N:
AUGGCUAGGCUAUAAAUGCGAUCCGAUUGA
Bila sintesis protein dimulai dari urutan basa nitrogen paling kiri maka peptide yang akan terbentuk...
A.     Satu macam
B.     Dua macam
C.     Tiga macam
D.     Empat macam
E.     Lima macam

Pembahasan :
Pada ARN.d tersebut terbentuk polipeptida dua macam
AUG (start kodon) GCU AGG CUA UAA (stop kodon)
AUG  (Start kodon) CGA UCC GAU UGA (stop kodon)
Terbentuk dua macam peptide
Jawaban : B

37.   Di bawah ini adalah tahap-tahap sintesis protein:
1. DNA membentuk RNA duta di dalam inti sel
2. Asam-asam amino diangkut oleh tRNA dari sitoplasma
3. RNA duta keluar dari inti sel
4. Terbentuk polipeptida
5. Asam-asam amino terangkai di dalam ribosom

Urutan tahapan sintesis protein adalah …
A.   1 – 2 – 3 – 4 – 5
B.    2 – 3 – 1 – 4 – 5
C.    1 – 3 – 2 – 4 – 5
D.   2 – 4 – 5 – 1 – 3
E.    1 – 3 – 2 – 5 – 4
UN 15-16

38.   Apabila rantai antisense memiliki urutan basa Nitrogen S-G-A-T-S, maka urutan basa Nitrogen pada RNA-d yang terbentuk adalah ...
A.   S-G-A-U-S
B.    S-G-A-T-S
C.    G-S-T-A-G
D.   G-S-U-A-G
E.    S-G-U-A-S

39.   Perhatikan tabel kodon dan asam amino berikut!
Kodon
Asam amino
CCU
A
GCA
B
GAU
C
CUA
D
UCC
E
AGG
F
UGC
G
ACG
H

Sepotong fragmen rantai sense DNA mempunyai urutan basa nitrogen sebagai berikut.


Rangkaian asam amino yang terbentuk adalah ....
A.   B – D – E – G
B.    A – C – E – F
C.    B – D – E – H
D.   A – D – F – G
E.    B – C – F – G
UN09-10

40.   Diagram langkah sintesis protein.


Bagian X pada diagram di atas menunjukkan ....
A.   DNA
B.    rRNA
C.    tRNA
D.   Rantai sense
E.    mRNA

Berlangganan Untuk Menerima Update Terbaru: